Goal: Make a final sequence which will contain the original plasmid of ferritin https://www.addgene.org/122652/
that will be combined with a flexible linker and spytag002 gene which should result in:
Ferritin (1 subunit of 24)-linker-spytag002
GGAGGCGGCGGCAGCTCTGGC | GTGCCTACTATCGTGATGGTGGACGCCTACAAGCGTTACAAG | AAGCTTGCGGCCGCACTCGAGCACCACCACCACCACC
in black there are overhangs which will combine with the ferritin construct after PCR amplification in Gibson assembly; in red spytag002 (plus maybe short linker 3 amino acids different)
After some struggles (in red highlight) and a lot of help from Claude AI I was able to get simulation properly from snapgene viewer in action>Gibson Assembly> Multiple Fragments
Assembled_gibson_ferritin_linker_spytag.dna


We'll use Gibson Assembly with two fragments: